Oceń: (0) (0)

dozota7

, 2007-10-11 17:23:49, 3 odp
Tematy: łańcuch, znajduje, procentodcinka

Jestem cienka z biologii i potrzebuje pomocy. Czy ktoś potrafi rozwiązać te zadania?

1.W DNA, otrzymanym z komórek nabłonkowych myszy, nukleotydy z adeniną
stanowią 24% liczby wszystkich nukleotydów. oblicz, ile procent w tym
DNA stanowią nukleotydy z cytozyną. przedstaw i wyjaśnij sposób
obliczania.

2.W cytoplazmie znajduje się mRNA o następującej sekwencji nukletydów: AUGACAAAAGGUGGCUGGUUC.
a)zapisz sekwencję nukleptydów w dwuniciowym fragmencie DNA, na którym zaszedł proces transkrypcji podanego odcinka mRNA.
b)podaj, z ilu aminokwasów będzie zbudowany łańcuch peptydowy, powstały w wyniku translacji tego fragmentu mRNA.
c) korzystając z tabeli kodu genetycznego, okresl sklad aminokwasowy peptydu powstalego po translacji tego odcinka mRNA.

Odpowiedzi udzielone na to pytanie

5 minut temu


Oceń: (0) (0)

~kasiasty 2010-11-01 20:08:21

http://dobryzarobek.pl/index.php?id=3e50f0a1217b95b5eff748ab9542b6c3

Oceń: (0) (0)

Animaru 2008-06-29 23:57:43

Zad. 1. adenina-24%
tymina-24% (musi jej być tyle samo co adeniny.)
To daje 48%. Zostaje więc 52%
52/2=26
26%cytozyny i tyleż samo guaniny.
Odp: Nukleotydy z cytozyną stanowią 26% tego DNA.
Zad. 2. c) metionina, treonina, lizyna, glicyna. glicyna, tryptofan, fenyloalanina.

Oceń: (0) (0)

Pati93 2007-11-09 17:16:01

a)TACTGTTTTCCACCACCAAG
   ATGACAAAAGGTGGTGGTTC
b)z 7

Zgłoś nadużycie

Dodaj odpowiedź do pytania

Teraz bez logowania

Zadaj własne pytanie

Teraz bez logowania

Inne pytania z tej kategorii

Robię prezentację o...

Autor: gife, Odpowiedzi: 1

Który z ptaków nie...

Autor: metweo, Odpowiedzi: 3

Dlaczego fokom i...

Autor: tatinati, Odpowiedzi: 3

Dlaczego porosty...

Autor: Marki, Odpowiedzi: 2